Nasal septal chondrocytes (NSCs) isolation
All the studies using nasal septal chondrocytes (NSCs) were conducted after written approval (HC13TISI0038) obtained from the Institutional Review Board of the Catholic Medical Center Clinical Research Coordinating Center. Human nasal septum tissue was harvested from five patients who were undergoing septoplasty [21]. Those tissues were cut into 1 mm3 pieces and they were enzymatically digested using 0.2 % protease solution (Gibco) for 60 min, followed by incubation in 0.3 % collagenase (Sigma-Aldrich) for 12 h at 37 °C. The isolated cells were then seeded in a 75-mm2 cell culture flask (NUNC) and cultivated in low-glucose Dulbecco’s Modified Eagle Medium (Gibco-BRL) with 10 % fetal bovine serum (FBS; Gibco) and antibiotics at 37 °C in 5 % CO2 incubator. The confluent chondrocytes were subcultured following a standard protocol using 0.05 % trypsin/EDTA solution (Gibco).
Preparation of NSCs-derived matrix: N-CHDM and S-CHDM
NSCs are loaded at the density of 1.3 × 104 cells/cm2 in a 100 mm diameter petri-dish and cultured for 7 days. At the time of confluence, the culture plates were washed twice with phosphate buffered saline (PBS) and subsequently subject to decellularization process. They were incubated briefly in a detergent solution containing 0.15 % Triton X-100 and 10 mM NH4OH (Sigma-Aldrich) at 37 °C, then treated with 50 U/mL DNase I and 2.5 µL/mL RNase A (Invitrogen) for 1 h, finally washed with PBS thoroughly and stored at 4 °C before use. We name it a natural NSC-derived matrix (N-CHDM). Meanwhile after the decellularization, N-CHDM was collected by gentle pipetting and this was transferred to 1 ml EP tube, then digested using 1 mg/ml pepsin (Sigma-Aldrich) in 0.01 N HCl for 48 h at 37 °C. These digested N-CHDM was neutralized via 0.1 N NaOH, and it was then diluted with 1X PBS. We call this a soluble NSC-derived matrix (S-CHDM). To prepare an S-CHDM substrate, the solution (50 µg/ml) was loaded onto TCP and incubated at 37 °C for 1 h as similar to fibronectin coating.
Characterization of N-CHDM
The surface morphology of N-CHDM was observed using phase contrast microscope (Carl Zeiss) and scanning electron microscope (SEM; Phenom G2 Pro Desktop). For immunofluorescence staining of ECM components, N-CHDM was prepared on the glass coverslips, fixed in 4 % paraformaldehyde, then washed with PBS more than three times. Subsequently these samples were treated with 0.2 % Triton X-100 solution for 30 min and they were blocked with 3 % bovine serum albumin (BSA). Once primary antibodies against human fibronectin (Santa Cruz, sc-271,098) and type 2 collagen (COL II) (Abcam, ab34712) were prepared in 1 % bovine serum albumin (BSA) solution, while diluted in 1:200, they were separately treated overnight at 4oC. As the secondary antibodies diluted in 1:500, Alexa fluoro-488 was used for fibronectin and rhodamine red-X (Invitrogen) was applied for COL II. The intensity and distribution of these ECM proteins were confirmed via confocal microscope (LSM700; Carl Zeiss).
NSC viability and proliferation
NSCs (P5) were seeded on three different substrates: tissue culture plate (TCP), S-CHDM, and N-CHDM, respectively. After 24 h culture on each substrate, cell viability was assessed via LIVE/DEAD® Viability/Cytotoxicity Kit (Invitrogen). Live or dead cells are visualized in green and red, respectively using a fluorescent microscope. Evaluation of cell proliferation was also carried out at 48 and 96 h using Cell Counting kit-8 (CCK-8; Dojindo). Briefly, each sample was added with 10 % CCK-8 solution and incubated at 37 °C for 2 h. The supernatant (200 µL) was then transferred to a 96-well plate and the absorbance of each sample was measured at 450 nm using a Multiskan microplate reader.
Focal adhesion (FA) assessment
Cell morphology on TCP, S-CHDM, and N-CHDM was also analyzed in 24 h. For this, NSCs were fixed with 4 % paraformaldehyde for 30 min, gently washed with PBS, and permeabilized with 0.2 % Triton X-100 for 20 min, then blocked with 1 % BSA for 1 h. Each sample was incubated with primary antibody against vinculin (Santa Cruz, sc-73,614) in 1 % BSA (1:300) overnight at 4 °C. After being rinsed three times with PBS, they were incubated with Alexa-Fluor-488-conjugated goat anti-mouse IgG (Invitrogen, A11001) in 1 % BSA (1:200) for 1 h at room temperature in the dark, followed by incubation with rhodamine phalloidin (Invitrogen, R415) for 30 min. Once these samples were washed, they were then mounted and observed via confocal microscope (LSM700; Carl Zeiss). Cell morphology was quantitatively assessed via cell spreading area and cell circularity. Those data were obtained by manually outlining cell borders (10 cells) per sample (n = 5, each group) and by processing the raw data using ImageJ software. In addition, the mean area of FA was also quantified for each test group using ImageJ.
Immunofluorescence staining of COL II
NSCs differentiation on three different microenvironments was carried out under the 10 % serum condition for 7 days and the result was assessed via immunofluorescence of COL II. The NSCs-loaded substrate was washed twice with PBS and blocked for 45 min with 3 % BSA. After they were incubated overnight with a mouse monoclonal anti-Col II (Abcam, ab34712) (1:200) at 4 °C, the samples were washed three times with PBS, incubated for 1 h with Alexa Fluor 488 goat anti-mouse IgG (1:200) at room temperature, and then rinsed with PBS. At the same time, DAPI staining was also conducted for nucleic detection. The fluorescent signals of COL II were detected using confocal microscope (LSM700; Carl Zeiss).
Quantitative real-time polymerase chain reaction (q-PCR)
For gene expression level of chondrogenic markers, q-PCR was carried out using the NSCs grown on three different substrates, respectively. First of all, total RNA was isolated from the NSCs of each group (n = 3) using TRIzol RNA Isolation Reagents (Invitrogen). The single-stranded cDNA was then prepared via a solution of RNA extracts, primers and reverse transcription (RT) reaction mixture. The reaction product (1 µL) was mixed with Maxime PCR PreMix (Intron) and Taqman primers and probes, then followed by polymerase chain reaction via Applied Biosystems 7300 Real-Time PCR system. The relative gene expression was calculated using ΔΔCt method, where each sample was internally normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH). The chondrogenic markers tested in this study are SRYbox containing gene 9 (Sox 9), Col 2, Aggrecan, and Col 10. Target genes and their primers are as follows: Sox9: AAAGGCAAGCAAAGGAGATG (forward) and TGGTGTTCTGAGAGGCACAG (reverse); Col 2: AAGGCTCCCAGAACATCACC (forward) and ATCCTTCAGGGCAGTGTACG (reverse); Aggrecan: TCTGTAACCCAGGCTCCAAC (forward) and TGGAGTACCTGGTGGCTCTC (reverse); Col 10: TGGGACCCCTCTTGTTAGTG (forward) and TTGGGTCATAATGCTGTTGC (reverse); housekeeping gene (GAPDH): GGGCTCTCCAGAACATCATC (forward) and TTCTAGACGGCAGGTCAGGT (reverse). The raw data are first normalized to GAPDH, and then normalized to that of TCP sample at 0 day. The results of gene expression are shown as a fold change relative to that of TCP (0 day).
Western blot analysis
For further analysis of chondrogenic markers, the NSCs were lysed using RIPA lysis buffer (Sigma-Aldrich). A total of 30 µg protein was subject to SDS-polyacrylamide gel electrophoresis (SDS-PAGE) with the use of 10 % resolving gels, then followed by transfer to polyvinylidene fluoride (PVDF) membrane (Bio-Rad). The membrane was incubated with primary antibodies specific for COL II (Abcam, ab34712), SOX9 (Santa Cruz, sc-166,505), Aggrecan (Santa Cruz, sc-70,332), COL I (Abcam, ab34710), and β-actin (Santa Cruz, sc-47,778), respectively, all of which were diluted in 1:1000. Those markers were visualized by chemiluminescence using Western ECL substrate (Thermo Scientific), and the luminescent images were analyzed using a LAS-3000 (Fujifilm).
NSCs differentiation in 3D polymer mesh scaffoldin vitro
To investigate the effect of NSCs grown on different 2D substrates, we transferred the NSCs into a 3D environment and examined the NSCs differentiation for up to 3 weeks. Poly l-lactic acid /polypropylene (PLLA/PP) (Ingelheim, Germany) microfibers were prepared using a rotary cutter and their nonwovens were fabricated into a mesh scaffold via modified wet-laid process as previously reported [22]. The surface morphology of mesh scaffold was examined via the SEM. Before cell seeding (1 × 105), mesh scaffolds were coated with fibronectin to ensure good cell attachment. After 24 h post-seeding, cell attachment in the scaffolds were evaluated via DAPI staining. The NSCs proliferation was also assessed at day 1, 3 and 5, respectively using CCK-8 assay. In addition, NSC differentiation in the scaffolds was assessed at 3 weeks via immunofluorescence of COL II, along with F-actin and DAPI staining, respectively. The fluorescent signals were detected using confocal microscope (LSM700; Carl Zeiss). The test samples are triplicated for each group.
Transplantation of NSCs-loaded mesh scaffold into ectopic modelin vivo
Animal study was implemented according to the guideline of the Institutional Animal Care and Use Committee of the Korea Institute of Science and Technology (IACUC, 2018-003). A subcutaneous ectopic model was prepared using 4 week-old SCID mice (Narabiotech, Korea). The experimental groups were divided into three (n = 4, each group), based on the NSCs that were pre-conditioned on TCP, S-CHDM, and N-CHDM, respectively. Prior to the in vivo transplantation, PKH-26 (PKH26 Red Fluorescent Cell Linker Kit, Sigma-Aldrich) labelled NSCs were prepared and they were then seeded at 5 × 105 cells per mesh scaffold. After 3 days of incubation in vitro, they were subcutaneously transplanted into the back of the mice right after anesthesia with Avertin. All the animals were sacrificed via overdose of anesthesia at 3 weeks post-transplantation. For histological analysis, we harvested the skin flaps at the transplantation site of each animal and processed them.
Histology: Hematoxylin-eosin and Safranin O staining
After the transplants were retrieved, each mesh scaffold was fixed in 4 % paraformaldehyde solution for 3 h, dehydrated with 100 % ethanol, washed with xylene, and then embedded in paraffin block. Thin sections of 5 μm thickness were made and placed on the glass slide. Once the specimens were deparaffinized using xylene and ethanol, they were stained by hematoxylin, followed by counterstaining of eosin. For quantitative analysis, PKH-26 labelled NSCs were observed via confocal microscope and the positive signals were analyzed quantitatively, based on the ratio of the positive area to the total area of the representative images (n = 5, per sample; 4 samples, each group) using imageJ. The number of chondrocyte with a lacunae structure was also calculated, based on the average count of NSCs with lacunae in the given area using imageJ (n = 5, per sample). Each sample is triplicated for each group. In addition, a routine protocol of Safranin-O/fast green staining was applied to the sections using aqueous Safranin-O (0.1 %, w/v) and fast green solution (0.001 %, w/v). Histological images were photographed using an optical microscope (Carl Zeiss).
Statistical analysis
All the data are expressed as mean ± standard deviation. Statistically significant difference is sought via one-way analysis of variance (ANOVA) with a post-hoc, Bonferroni’s multiple comparison tests using GraphPad Prism 7 (GraphPad Software). A significant difference is marked as * (p < 0.05), ** (p < 0.01), or *** (p < 0.001).