Skip to main content

Table 1 Primers used for qRT-PCR in this study

From: Biosilicated collagen/β-tricalcium phosphate composites as a BMP-2-delivering bone‐graft substitute for accelerated craniofacial bone regeneration

Marker gene Primer sequence (5’ → 3’) Tm
(°C)
Reference
COL Forward CTTCACCTACAGCACCCTTGTG 59 This study
  Reverse TGACTGTCTTGCCCCAAGTTC 58 This study
OCN Forward GTGAGCTTAACCCTGCTTGTGA 58 This study
  Reverse TGCGTTTGTAGGCGGTCTTC 60 This study
GAPDH Forward CCTGGCCAAGGTCATCCATG 62 Ref. [20]
  Reverse GCAGGAGACAACCTGGTCCT 62 Ref. [20]