Skip to main content

Table 1 Sequence lists for the primers used in this study

From: Nanoengineered, cell-derived extracellular matrix influences ECM-related gene expression of mesenchymal stem cells

Gene Forward Primer (5′ → 3′) Reverse Primer (5′ → 3′)
GAPDH GTATGACAACAGCCTCAAGAT AGTCCTTCCACGATACCAAA
FN1 AGCAGACCCAGCTTAGAGTT GCAGAAGTGTTTGGGTGACT
COL1A1 GGGCCAAGACGAAGACAT CAACACCCTTGCCGTTGTCG
COL4A1-A2 CTGGTCCAAGAGGATTTCCA TCATTGCCTTGCACGTAGAG
COL2A1 GGCAATAGCAGGTTCACGTACA CGATAACAGTCTTGCCCCCACTT
LAMB1 AACGTGGTTGGAAGAACCTG ACACTCCCTGGAAACAGTGG
DCN AATTGAAAATGGGGCTTTCC GCCATTGTCAACAGCAGAGA
BGN GGACTCTGTCACACCCACCT AGCTCGGAGATGTCGTTGTT
ACAN TGCGGGTCAACAGTGCCTATC CACGATGCCTTTCACCACGAC