Skip to main content

Table. 1 Genes used for RT-PCR

From: The effects of the molecular weights of hyaluronic acid on the immune responses

Gene Primers (5′→3′) Accession number
IL-1β FW: AAATGCCACCTTTTGACAGTGA
REV: TCATATGGGTCCGACAGCAC
NM_008361.4
TNF-α FW: TCAAAATTCGAGTGACAAGCCT
REV: TCCAAAGTAGACCTGCCCG
NM_013693.3
IL-6 FW: AGTCCGGAGAGGAGACTTCA
REV: TTGGAAATTGGGGTAGGAAGGA
NM_031168.2
CCL2 FW: CCCAATGAGTAGGCTGGAGAG
REV: CTGTCACACTGGTCACTCCTAC
NM_011333.3
IL-11 FW: CTGACGGAGATCACAGTCTGGA
REV:GGACATCAAGTCTACTCGAAGCC
NM_008350.4
TGF-β1 FW: ATGCTAAAGAGGTCACCCGC
REV:TTCCGTCTCCTTGGTTCAGC
NM_011577.2
IL-10 FW: GCTGGACAACATACTGCTAACC
REV: ATTTCCGATAAGGCTTGGCAA
NM_010548.2
Arg1 FW: CATTGGCTTGCGAGACGTAGAC
REV: GCTGAAGGTCTCTTCCATCACC
NM_007482.3
GAPDH FW: TCAACGACCCCTTCATTGAC
REV:ATGCAGGGATGATGTTCTGG
NM_008084.3