Skip to main content

Table 1 Primer sequences

From: Calcium phosphates and silicon: exploring methods of incorporation

Name Primer sequences (5’-3’)
ALP ACAAGCACTCCCACTTCATC
TTCAGCTCGTACTGCATGTC
OP CTCCATTGACTCGAACGACTC
CAGGTCTGCGAAACTTCTTAGAT
RUNX2 TGGTTACTGTCATGGCGGGTA
TCTCAGATCGTTGAACCTTGCTA
OC TGAGAGCCCTCACACTCCTC
CGCCTGGGTCTCTTCACTAC
BMP2 ACTACCAGAAACGAGTGGGAA
GCATCTGTTCTCGGAAAACCT
GAPDH CGCTCTCTGCTCCTCCTGTT
CCATGGTGTCTGAGCGATGT
\