Skip to main content

Table 2 Real time-qPCR primer and product size

From: Light enhanced bone regeneration in an athymic nude mouse implanted with mesenchymal stem cells embedded in PLGA microspheres

Gene Sequence (5′ → 3′) Size (bp) Cycle Annealing temp. Ref.
β-Actin (S) ACAGAGCCGCCTCTGCC 124 45 58 °C Genebank AB009345
COLI (S) GCAAGAGAGAAAAGAGTGAACC 103 45 58 °C Genebank AY633663
Cbfa-1 (S) CAGTCACATCAGGATATCC 117 45 58 °C Genebank L38480
OCN (S) CTCCAGGCACCCATCTTTAC 121 45 58 °C Genebank NM00095