Skip to main content

Table 1 PCR primer and product size

From: Light enhanced bone regeneration in an athymic nude mouse implanted with mesenchymal stem cells embedded in PLGA microspheres

Gene Sequence (5′ → 3′) Size (bp) Cycle Annealing temp. Ref.
COLI (S) AGAACATCACCTACCACTGC 250 35 58 °C Genebank AY633663
(AS) ATGTCCAAAGGTGCAATATC
Cbfa-1 (S) AGAGGTACCAGATGGGACTGTGGTT 316 35 61 °C Genebank S83370
(AS) GGTAGCTACTTGGGGAGGATTTGTG
BSP (S) CAATAGTGACTCATCCGAAG 280 35 55 °C Genebank Z46629
(AS) CTCCTCATCTTATTCATCAC
GAPDH (S) TCACAATCTTCCAGGAGCGA 293 35 58 °C Genebank L23961
(AS) CACAATGCCGAAGTGGTCGT